Interactions of the RNA polymerase of bacteriophage T 7 with its promoter during binding and initiation of transcription ( " footprinting " / methidiumpropyl - EDTA / mRNA )

Promoters for T7 RNA polymerase have a highly conserved sequence of 23 continuous base pairs located at position -17 to +6 relative to the initiation site for the RNA. The complex of T7 RNA polymerase with the phage 410 promoter has been visualizedindirectly by exploiting the ability of the polymerase to protect DNA sequences from cleavage by methidiumpropyl-EDTA-Fe(II). The DNA contacts made by T7 RNA polymerase have been mapped during binding and during the subsequent initiation of transcription. The RNA polymerase alone protects 19 bases in a region from -21 to -3. Synthesis of the trinucleotide r(GGG) expands the length of the sequence protected by the RNA polymerase and stabilizes the complex; 29 bases (-21 to +8) are protected, and the observed equilibrium association constant of the r(GGG) complex is 5 x 105 M-1. The formation of a hexanucleotide mRNA, r(GGGAGA), further extends the protected region; 32 bases (-21 to +11) are protected. Finally, the synthesis of a pentadecanucleotide mRNA leads to a translocation of the region protected by the protein; the sequence now protected is reduced to 24 bases (-4 to +20). Gene I ofbacteriophage T7 encodes an RNA polymerase that is responsible for the expression of the rightmost 80% of the T7 genome (1) and is also involved in the initiation of DNA replication (2-4). In contrast to the multisubunit RNA polymerases of bacteria and eukaryotes, T7 RNA polymerase consists of a single polypeptide of molecular weight 98,856 (5, 6). The physical and catalytic properties of the enzyme have been well documented (7, 8). Seventeen T7 RNA polymerase promoters are present on the T7 DNA molecule (Fig. 1), and all are oriented for rightward transcription. The promoters consist of a highly conserved 23-base-pair (bp) sequence (9-11). The 410 promoter, the promoter used in this study, is one of the strongest in vivo and in vitro (9); it has a sequence identical to that of the consensus sequence derived from all 17 promoters. A useful tool for the identification of the DNA binding sites of small molecules and proteins is the protection of the nucleic acid from cleavage by enzymatic or chemical reagents. For example, the binding sites for netropsin (12), actinomycin (12), lac repressor (13), and Escherichia coli RNA polymerase (14-16) have been determined by using this "DNA footprinting" technique. Furthermore, in the case of E. coli RNA polymerase, sequential changes in the protected sequences reveal stepwise conformational changes of the enzyme during the initiation of transcription (15, 16). The interaction of T7 RNA polymerase with its promoters is weak; the binding constant is estimated to be <107 M-1 (5, 17). Consequently, high concentrations of the enzyme are required to visualize the protection of specific sequences. In this communication we use overproduced T7 RNA polymerCONSENSUS . SEOUENCE: TAATACGACTCACTATAGGGAGA 1 ",1 K IL I 46 7 11131.7 2 2.53.54 5 6 7 8 9 1011 12 14 15 ilium iflm _